Latex Text über zeilenrand

Luu123

Cadet 3rd Year
Dabei seit
Nov. 2016
Beiträge
59
Hi,
bevor ich mein problem schildere möchte ich anmerken das ich sehr voll zuerst google befragt habe und auch einige kommentare dazu gelesen habe. Jedoch hab ich bis her keine antwort auf mein problem gefunden, womöglich weil ich auch nur falsch suche aber ich weiß auch nicht so recht wie ich mich formulieren soll.

Jetz zu meinem Problem:
Ich schreibe gerade an einer wissenschaftlichen Arbeit und möchte im appendix einen laengeren Textblock einfügen.
Dieser Text verhält sich aber äußerst widerspenstig: Das problem liegt darin das der text über die Ränder des Dokumentes herauslangen und so kann ich das einfach nicht verwerten. Dazu kommen einfach aus dem nichts wiedermal leerstellen.
Hab es sowohl mit minipage als auch parbox versucht

Minimalbsp

\documentclass[11pt,a4paper]{report}
\setlength{\parindent}{0pt}
\usepackage[utf8]{inputenc}

\begin{document}
\apendix
AAAAGCTGGAGCTCCAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAA
TTTGTGATGCTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAA
CAATTGCATTCATTTTATGTTTCAGGTTCAGGGGGAGGTGTGGGAGGTTTTTTAAAGCAAG
TAAAACCTCTACAAATGTGGTATGGCTGATTATGATCTAGAGTCGCGGCCGCTTTACTTGT
ACAGCTCGTCCATGCCGAGAGTGATCCCGGCGGCGGTCACGAACTCCAGCAGGACCATGTGA
TCGCGCTTCTCGTTGGGGTCTTTGCTCAGGGCGGACTGGGTGCTCAGGTAGTGGTTGTCGGG
CAGCAGCACGGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGGTCGGCGAGCTGCACGC
TGCCGTCCTCGATGTTGTGGCGGATCTTGAAGTTGGCCTTGATGCCGTTCTTCTGCTTGTCG
GCGGTGATATAGACGTTGTGGCTGATGTAGTTGTACTCCAGCTTGTGCCCCAGGATGTTGCC
GTCCTCCTTGAAGTCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTGTCGCCCTCGAACTT
CACCTCGGCGCGGGTCTTGTAGTTGCCGTCGTCCTTGAAGAAGATGGTGCGCTCCTGGACGTA
GCCTTCGGGCATGGCGGACTTGAAGAAGTCGTGCTGCTTCATGTGGTCGGGGTAGCGGCTGAA
GCACTGCACGCCCCAGGTCAGGGTGGTCACGAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGT
GGTGCAGATGAACTTCAGGGTCAKCTTGCCGTAGGTGGCATCGCCCTCGCCCTCGCCGGACAC
GCTGAACTTGTGGCCGTTTACGTCGCCGTCCAGCTCGACCAGGATGGGCACCACCCCGGTGAA
CAGCTCCTCGCCCTTGCTCATGGTGGCGACCGGTGGATCCACTAGTAACGGCCGCCAGTGTGC
TGGAAATTCGGCTTGAACCTTTCGGTANC

\end{document}
 

ExoTerra

Lt. Junior Grade
Dabei seit
Juli 2010
Beiträge
435
Studiert da etwa jemand Biotechnologie ? ;)
Würde auch mal \sloppy probieren das hat mir imemr geholfen bei DNA-Sequenzen
 

Rage

Commander
Dabei seit
Feb. 2009
Beiträge
2.290
Ich kann Dir zu Deinem Problem leider noch nichts sagen, aber es ist aus mehreren Gründen kein guter Stil, parindent auf 0pt zu setzen. Zum Einen geht Dir dadurch die saubere Absatztrennung verloren, zum Anderen wird diese Variable von TeX an mehreren Stellen verwendet. Wenn Du keinen Einzug haben willst, dann verwende mit der report-Klasse einfach das Paket parskip, mit dem Paket enumitem kannst Du eventuelle Schwierigkeiten mit Aufzählungen dann beseitigen.

Edit: Wenn Dein Ziel tatsächlich DNA-Sequenzen in LaTeX sind, dann benutze am besten dieses Paket. Von der Verwendung von \sloppy sollte man aus typographischen Gründen für gewöhnlich absehen, wenn, dann nur lokal verwenden (der Link von powerfx führt auf eine Website, wo die lokale Variante aufgeführt ist).
 
Zuletzt bearbeitet:

Luu123

Cadet 3rd Year
Ersteller dieses Themas
Dabei seit
Nov. 2016
Beiträge
59
Hi,
danke für die antworten.
Ich werd mal sloppy ausborobieren und mal parindent entfernen.

@ExoTerra : Bio normal, das ist meine Bakk arbeit :)
 

Rage

Commander
Dabei seit
Feb. 2009
Beiträge
2.290
\sloppy hat Einfluss auf das gesamte Dokument und hat im Zweifel deutlich schlechter lesbaren Text zur Folge. Ich kann Dir nur empfehlen, das Paket seqsplit zu verwenden, das ich in meiner ersten Antwort verlinkt habe.
 

Luu123

Cadet 3rd Year
Ersteller dieses Themas
Dabei seit
Nov. 2016
Beiträge
59
Danke @Rage,
\seqsplit hat genau das gemacht was ich wollte und das auch noch schnell und unkompliziert.

Danke an alle die mir geholfen haben.

---Closed---
 
Top